so what is the "code" ??

Now that we have discussed what DNA is and how it is used as a template to assemble proteins, let's take a look at how our DNA is regulated...how your cells are able to "decide" which genes to use (turn on expression) and which to not use (turn off expression.  

Prokaryotes can control their gene expression in a more direct manor since their DNA is not sequestered in a nucleus. An example of prokaryotic gene regulation

describes how bacteria regulate the expression of their gene that codes for the enzyme lactase which is used to digest lactose.
This system is called the Lac Operon.

the polypeptide folds as the amino acids
 R groups interact with one another forming a particular protein shape which determines the protein's function

so tRNA, mRNA and the ribosome all work together to align specific amino acids in a particular order for a particular protein

this is the mRNA codon chart

what's a ribosome ?

 microbial growth and nutrition

enzymes used during transcription:
DNA Helicase
RNA Polymerase​ 

Regulation of DNA

How do Prokaryotes control their gene expression?? 

ignore below...

example 2: 
​"royal" jelly
 
methylates the Dnmt3 gene, turning it off so no Dnmt3 protein is made.
​ Dnmt3 silences queen genes. 
So this then upregulates the queen genes normally silenced
by the Dnmt3 protein

Eukaryotes
can regulate their gene expression ...
  1. before transcription
2. after transcription
  3. during translation
  4. after translation

the DNA determines in what order the different amino acids are linked together which determines how the polypeptide folds as the R groups of the different amino acids interact with one another.

How the polypeptide folds determines the shape of the protein which determines the protein's function

4. Post Translational Regulation:
protein activation/modification 

tag = acetyl group 

​​​At birth, the GR gene is highly methylated and inactive. If a rat mother is attentive towards her pups, the pups' GR gene gradually demethylates, making the gene more active. Pups not given attention poorly express the GR gene and therefore respond poorly to stress.

lactose is absent

Now that we know how DNA serves as the cookbook to make proteins, what happens when there is a typo in the recipe...
 a mutation in the DNA??

scientists have isolated the Cas proteins and are able to use them along with manufactured RNA to target specific genes for editing.

                                                                   The answer is...
           transcription into mRNA transcript = GACC/AUG/CCU/ACG/GCC/UGU/GGC/UAA/CGGC
                                                                                          *START                                                     STOP
             *remember to always start at the sequence AUG no matter what is upstream of this codon
       translation into amino acid chain = ​ methionine:proline:threonine:alanine:cysteine:glycine

Welcome to Dr. Kate Brilakis' Learning Portal

lactose is present

    potentially one codon is changed

3. Translational Regulation:

 a. ribosomal activation 
​b. RNA stability

what's tRNA ??

2. Post-Transcriptional Regulation:
​transcript modification using
a. intron/exon splicing
b. methyl cap
​c. poly A tail

step one: Transcription

example 1:
 modifying expression of the GR gene:
The glucocorticoid receptor (GR, or GCR) also known as NR3C1, is the receptor to which cortisol and other glucocorticoids bind. The GR is expressed in almost every cell in the body and regulates genes controlling development, metabolism, and immune response.

how do mutations affect phenotype?

remember amino acids are linked together to make a polypeptide chain which folds into a functional protein

transcription factors are proteins that bind to specific DNA sequences to regulate the transcription of DNA to mRNA. These factors bind to either the enhancer or promotor regions of the genes they act to regulate.    

what is CRISPR?

But when lactose is present,
​the bacterium needs lactase to digest the lactose.

So, the repressor protein has to be deactivated so the lactase gene can be transcribed. The lactose binds to the repressor, changing its shape. Now, the repressor can't bind to the operator.
The  RNA polymerase is able to move down over the operator and transcribe the lactase genes. The lactase mRNA can then be translated and lactase is made. 

When lactose (sugar) is absent,
​the bacterium doesn't need to produce lactase.

So, there is a repressor protein that binds to a stretch of DNA upsteam of the lactase genes. This stretch of DNA is called the operator. When the repressor is bound to the operator, it prevents the RNA polymerase from moving past it (like a roadblock) and transcribing the lactase genes. No mRNA is made so no lactase can be made.

example 3:
Bisphenol A (BPA)

reduces methylation of the agouti gene, turning this gene on. 

 DNA Function : Protein Synthesis

also needed for translation is the mRNA assembled during transcription (step one of protein synthesis) and another form of RNA called tRNA.

(a) transcription factors 

the sequence of the RNA nucleotides determines how the amino acids are lined up next to one another and bonded together forming a polypeptide which then...

 remember, cytosine C is one of the four nucleotides

types of mutations

(b) epigenetic tags (factors)

Jennifer Doudna
Professor of Chemistry and Molecular and Cell Biology at U.C. Berkeley.
Developed a process for
editing the DNA of any organism using an RNA-guided protein found in bacteria. This technology, called CRISPR-Cas9, has opened the floodgates of possibility for human and non-human applications of gene editing, including assisting researchers in the fight against HIV, sickle cell disease and muscular dystrophy. Doudna is an investigator with the Howard Hughes Medical Institute, senior investigator at Gladstone Institutes, and the Executive Director of the Innovative Genomics Institute. She is a member of the National Academy of Sciences, the National Academy of Medicine, the National Academy of Inventors, and the American Academy of Arts and Sciences. She is the co-author of A Crack in Creation, a personal account of her research and the societal and ethical implications of gene editing. She is a vocal proponent of its responsible use, first calling for a moratorium on using CRISPR technology to make permanent changes to the human germline in 2015.

extra credit question:
how does the DNA direct the assembly of a polypeptide chain?

extra credit question:
plasmids can be constructed to serve us via in vitro recombination.
they can also participate in the evolution of deadly superbugs.

Is this a contradiction?

Bacteria use special proteins called Cas proteins to protect against phage viruses. Cas proteins excise viral DNA which is then inserted into the bacterium's DNA.

​Next time the bacterium is attacked by the virus, it can destroy the virus using a Cas protein and the mRNA transcribed from the viruses DNA. 

tag = methyl group (CH3)

Current Topics in molecular biology

    deacetylating histones           tightens DNA =
   prevents transcription

construct a DNA polymer

​pleiotropic effects including yellow fur, maturity-onset obesity, hyperinsulinemia, insulin resistance, hyperglycemia

mutations produce new phenotypes by creating novel allelic versions of a gene.

Foods high in L-methylfolate include:

step two: Translation

Protein Synthesis occurs in two steps:

1. transcription

2. translation

insertion

plasmids:
​specific to bacteria...

    point mutations can be:
 a.  substitutions
​ b. insertions or deletions

lactose is absent

DNA monomers

lets review
​ DNA Structure

insertions and deletions can also be multiple nucleotides

click on this pic to see the newest discoveries in science and medicine

 methylating cytosines tightens DNA               = ​prevents transcription

1. Before Transcription:
Transcriptional Regulation using (a) transcription factors and (b) epigenetic tags

review

lactose is present

Try  this...
Transcribe and translate the following DNA sequence(template strand):
CTGGTACGGATGCCGGACACCGATTGCCG​

Protein Synthesis Step Two: Translation

 Your epigenome exhibits epigenetic "tags" which modify how tightly the DNA is "condensed", that is how tightly the DNA is wrapped around histone proteins. The more condensed the DNA, the less accessible it is to RNA Polymerase for transcription. The less condensed the DNA, the more accessible for transcription. 

this movie is pretty advanced but it discusses "riboswitches",

small molecules that can permit/prevent

translation

making copies of DNA = DNA Replication
occurs during binary fission

a targeted gene can either be disrupted (=silenced/deleted)
or a new gene inserted at the targeted site

    acetylating histones                loosens DNA =
   permits transcription

even in viruses...

the sequence of the DNA nucleotides in the DNA is used to assemble a strand of RNA using RNA nucleotides which then carries this sequence from the nucleus where the DNA is stored into the cytoplasm where the ribosomes are located

deletion

    potentially every  codon from point of insertion or deletion is changed