Welcome to Dr. Kate Brilakis' Learning Portal
lactose is present
potentially every codon from point of insertion or deletion is changed
Foods high in L-methylfolate include:
this page is extra credit!
making copies of DNA = DNA Replication
occurs during binary fission
mutations produce new phenotypes by creating novel allelic versions of a gene.
how do mutations affect phenotype?
example 3:
Bisphenol A (BPA)
reduces methylation of the agouti gene, turning this gene on.
point mutations can be:
a. substitutions
b. insertions or deletions
Jennifer Doudna
Professor of Chemistry and Molecular and Cell Biology at U.C. Berkeley.
Developed a process for
editing the DNA of any organism using an RNA-guided protein found in bacteria. This technology, called CRISPR-Cas9, has opened the floodgates of possibility for human and non-human applications of gene editing, including assisting researchers in the fight against HIV, sickle cell disease and muscular dystrophy. Doudna is an investigator with the Howard Hughes Medical Institute, senior investigator at Gladstone Institutes, and the Executive Director of the Innovative Genomics Institute. She is a member of the National Academy of Sciences, the National Academy of Medicine, the National Academy of Inventors, and the American Academy of Arts and Sciences. She is the co-author of A Crack in Creation, a personal account of her research and the societal and ethical implications of gene editing. She is a vocal proponent of its responsible use, first calling for a moratorium on using CRISPR technology to make permanent changes to the human germline in 2015.
DNA monomers
ignore below...
extra credit question:
how does the DNA direct the assembly of a polypeptide chain?
lets review
DNA Structure
this movie is pretty advanced but it discusses "riboswitches",
small molecules that can permit/prevent
translation
types of mutations
Now that we have discussed what DNA is and how it is used as a template to assemble proteins, let's take a look at how our DNA is regulated...how your cells are able to "decide" which genes to use (turn on expression) and which to not use (turn off expression.
even in viruses...
lactose is absent
Your epigenome exhibits epigenetic "tags" which modify how tightly the DNA is "condensed", that is how tightly the DNA is wrapped around histone proteins. The more condensed the DNA, the less accessible it is to RNA Polymerase for transcription. The less condensed the DNA, the more accessible for transcription.
the sequence of the DNA nucleotides in the DNA is used to assemble a strand of RNA using RNA nucleotides which then carries this sequence from the nucleus where the DNA is stored into the cytoplasm where the ribosomes are located
example 2:
"royal" jelly
methylates the Dnmt3 gene, turning it off so no Dnmt3 protein is made.
Dnmt3 silences queen genes.
So this then upregulates the queen genes normally silenced
by the Dnmt3 protein
Prokaryotes can control their gene expression in a more direct manor since their DNA is not sequestered in a nucleus. An example of prokaryotic gene regulation
describes how bacteria regulate the expression of their gene that codes for the enzyme lactase which is used to digest lactose.
This system is called the Lac Operon.
3. Translational Regulation:
a. ribosomal activation
b. RNA stability
4. Post Translational Regulation:
protein activation/modification
plasmids:
specific to bacteria...
Now that we know how DNA serves as the cookbook to make proteins, what happens when there is a typo in the recipe...
a mutation in the DNA??
the DNA determines in what order the different amino acids are linked together which determines how the polypeptide folds as the R groups of the different amino acids interact with one another.
How the polypeptide folds determines the shape of the protein which determines the protein's function
lactose is present
deletion
a targeted gene can either be disrupted (=silenced/deleted)
or a new gene inserted at the targeted site
Protein Synthesis occurs in two steps:
1. transcription
2. translation
insertions and deletions can also be multiple nucleotides
so tRNA, mRNA and the ribosome all work together to align specific amino acids in a particular order for a particular protein
also needed for translation is the mRNA assembled during transcription (step one of protein synthesis) and another form of RNA called tRNA.
Genetics
remember, cytosine C is one of the four nucleotides
remember amino acids are linked together to make a polypeptide chain which folds into a functional protein
so what is the "code" ??
At birth, the GR gene is highly methylated and inactive. If a rat mother is attentive towards her pups, the pups' GR gene gradually demethylates, making the gene more active. Pups not given attention poorly express the GR gene and therefore respond poorly to stress.
example 1:
modifying expression of the GR gene:
The glucocorticoid receptor (GR, or GCR) also known as NR3C1, is the receptor to which cortisol and other glucocorticoids bind. The GR is expressed in almost every cell in the body and regulates genes controlling development, metabolism, and immune response.
step two: Translation
But when lactose is present,
the bacterium needs lactase to digest the lactose.
So, the repressor protein has to be deactivated so the lactase gene can be transcribed. The lactose binds to the repressor, changing its shape. Now, the repressor can't bind to the operator.
The RNA polymerase is able to move down over the operator and transcribe the lactase genes. The lactase mRNA can then be translated and lactase is made.
potentially one codon is changed
the sequence of the RNA nucleotides determines how the amino acids are lined up next to one another and bonded together forming a polypeptide which then...
1. Before Transcription:
Transcriptional Regulation using (a) transcription factors and (b) epigenetic tags
tag = acetyl group
(b) epigenetic tags (factors)
Bacteria use special proteins called Cas proteins to protect against phage viruses. Cas proteins excise viral DNA which is then inserted into the bacterium's DNA.
Next time the bacterium is attacked by the virus, it can destroy the virus using a Cas protein and the mRNA transcribed from the viruses DNA.
Current Topics in molecular biology
this is the mRNA codon chart
Protein Synthesis Step Two: Translation
How do Prokaryotes control their gene expression??
2. Post-Transcriptional Regulation:
transcript modification using
a. intron/exon splicing
b. methyl cap
c. poly A tail
Regulation of DNA
deacetylating histones tightens DNA =
prevents transcription
methylating cytosines tightens DNA = prevents transcription
the polypeptide folds as the amino acids
R groups interact with one another forming a particular protein shape which determines the protein's function
what is CRISPR?
click on this pic to see the newest discoveries in science and medicine
(a) transcription factors
step one: Transcription
construct a DNA polymer
acetylating histones loosens DNA =
permits transcription
what's tRNA ??
lactose is absent
Try this...
Transcribe and translate the following DNA sequence(template strand):
CTGGTACGGATGCCGGACACCGATTGCCG
The answer is...
transcription into mRNA transcript = GACC/AUG/CCU/ACG/GCC/UGU/GGC/UAA/CGGC
*START STOP
*remember to always start at the sequence AUG no matter what is upstream of this codon
translation into amino acid chain = methionine:proline:threonine:alanine:cysteine:glycine
When lactose (sugar) is absent,
the bacterium doesn't need to produce lactase.
So, there is a repressor protein that binds to a stretch of DNA upsteam of the lactase genes. This stretch of DNA is called the operator. When the repressor is bound to the operator, it prevents the RNA polymerase from moving past it (like a roadblock) and transcribing the lactase genes. No mRNA is made so no lactase can be made.
pleiotropic effects including yellow fur, maturity-onset obesity, hyperinsulinemia, insulin resistance, hyperglycemia
extra credit question:
plasmids can be constructed to serve us via in vitro recombination.
they can also participate in the evolution of deadly superbugs.
Is this a contradiction?
DNA Function : Protein Synthesis
tag = methyl group (CH3)
insertion
what's a ribosome ?
Eukaryotes
can regulate their gene expression ...
1. before transcription
2. after transcription
3. during translation
4. after translation
enzymes used during transcription:
DNA Helicase
RNA Polymerase
scientists have isolated the Cas proteins and are able to use them along with manufactured RNA to target specific genes for editing.
transcription factors are proteins that bind to specific DNA sequences to regulate the transcription of DNA to mRNA. These factors bind to either the enhancer or promotor regions of the genes they act to regulate.
review