Welcome to Dr. Kate Brilakis' Learning Portal

so what is the "code" ??

    potentially every  codon from point of insertion or deletion is changed

Protein Synthesis Step One:
​Transcription 

mutations produce new phenotypes by creating novel allelic versions of a gene.

click on this pic to see the newest discoveries in science and medicine

5C sugar

    deacetylating histones           tightens DNA =
   prevents transcription

 DNA Function : Protein Synthesis

Protein Synthesis occurs in two steps:

1. transcription

2. translation

Prokaryotes can control their gene expression in a more direct manor since their DNA is not sequestered in a nucleus. An example of prokaryotic gene regulation

describes how bacteria regulate the expression of their gene that codes for the enzyme lactase which is used to digest lactose.
This system is called the Lac Operon.

(b) epigenetic tags (factors)

 DNA is organized into Chromosomes

4. Post Translational Regulation:
protein activation/modification 

But when lactose is present,
​the bacterium needs lactase to digest the lactose.

So, the repressor protein has to be deactivated so the lactase gene can be transcribed. The lactose binds to the repressor, changing its shape. Now, the repressor can't bind to the operator.
The  RNA polymerase is able to move down over the operator and transcribe the lactase genes. The lactase mRNA can then be translated and lactase is made. 

lactose is present

(a) transcription factors 

                                                                   The answer is...
           transcription into mRNA transcript = GACC/AUG/CCU/ACG/GCC/UGU/GGC/UAA/CGGC
                                                                                          *START                                                     STOP
             *remember to always start at the sequence AUG no matter what is upstream of this codon
       translation into amino acid chain = ​ methionine:proline:threonine:alanine:cysteine:glycine

enzymes used during transcription:
DNA Helicase
RNA Polymerase​ 

also needed for translation is the mRNA assembled during transcription (step one of protein synthesis) and another form of RNA called tRNA.

Try  this...
Transcribe and translate the following DNA sequence(template strand):
CTGGTACGGATGCCGGACACCGATTGCCG​

    potentially one codon is changed

here are all four:

G for Guanine
T for Thymine
C for Cytosine
A for Adenine 

nucleotides with a double ring nitrogenous base (A and G)
are called Purines

nucleotides with a single ring nitrogenous base (C and T)
are called Pyrimidines


 DNA (deoxyribonucleic acid)
​= Polymer

transcription factors are proteins that bind to specific DNA sequences to regulate the transcription of DNA to mRNA. These factors bind to either the enhancer or promotor regions of the genes they act to regulate.    

example 2: 
​"royal" jelly
 
methylates the Dnmt3 gene, turning it off so no Dnmt3 protein is made.
​ Dnmt3 silences queen genes. 
So this then upregulates the queen genes normally silenced
by the Dnmt3 protein

Jennifer Doudna
Professor of Chemistry and Molecular and Cell Biology at U.C. Berkeley.
Developed a process for
editing the DNA of any organism using an RNA-guided protein found in bacteria. This technology, called CRISPR-Cas9, has opened the floodgates of possibility for human and non-human applications of gene editing, including assisting researchers in the fight against HIV, sickle cell disease and muscular dystrophy. Doudna is an investigator with the Howard Hughes Medical Institute, senior investigator at Gladstone Institutes, and the Executive Director of the Innovative Genomics Institute. She is a member of the National Academy of Sciences, the National Academy of Medicine, the National Academy of Inventors, and the American Academy of Arts and Sciences. She is the co-author of A Crack in Creation, a personal account of her research and the societal and ethical implications of gene editing. She is a vocal proponent of its responsible use, first calling for a moratorium on using CRISPR technology to make permanent changes to the human germline in 2015.

Regulation of DNA

lactose is absent

this movie is pretty advanced but it discusses "riboswitches",

small molecules that can permit/prevent

translation

lactose is absent

When lactose (sugar) is absent,
​the bacterium doesn't need to produce lactase.

So, there is a repressor protein that binds to a stretch of DNA upsteam of the lactase genes. This stretch of DNA is called the operator. When the repressor is bound to the operator, it prevents the RNA polymerase from moving past it (like a roadblock) and transcribing the lactase genes. No mRNA is made so no lactase can be made.

insertions and deletions can also be multiple nucleotides

 Human DNA exhibits >3.3 billion nucleotides. If they were printed on a
giant piece of paper, with 50 letters per square inch, paper would be 8 football fields in size. On average, an genome of one human is different from another human by just six million nucleotides. 

 remember, cytosine C is one of the four nucleotides

          The Structure and Function of DNA

​​​At birth, the GR gene is highly methylated and inactive. If a rat mother is attentive towards her pups, the pups' GR gene gradually demethylates, making the gene more active. Pups not given attention poorly express the GR gene and therefore respond poorly to stress.

Bacteria use special proteins called Cas proteins to protect against phage viruses. Cas proteins excise viral DNA which is then inserted into the bacterium's DNA.

​Next time the bacterium is attacked by the virus, it can destroy the virus using a Cas protein and the mRNA transcribed from the viruses DNA. 

even in viruses...

deletion

what is CRISPR?

this is the mRNA codon chart

a targeted gene can either be disrupted (=silenced/deleted)
or a new gene inserted at the targeted site

lactose is present

types of mutations

 DNA Structure

but first...what is RNA?

Protein Synthesis Step Two: Translation

example 3:
Bisphenol A (BPA)

reduces methylation of the agouti gene, turning this gene on. 

Eukaryotes
can regulate their gene expression ...
  1. before transcription
2. after transcription
  3. during translation
  4. after translation

scientists have isolated the Cas proteins and are able to use them along with manufactured RNA to target specific genes for editing.

so tRNA, mRNA and the ribosome all work together to align specific amino acids in a particular order for a particular protein

 ​DNA nucleotides
​ = Monomers 

tag = methyl group (CH3)

enzymes used during replication: 
* DNA Helicase (unzips DNA) 
( RNA Primase lays down RNA primer)
*DNA Polymerase (directionally specific builds DNA)
*DNA Ligase (connects okazaki fragments)


occurs in a molecular machine called a ribosome

 Your epigenome exhibits epigenetic "tags" which modify how tightly the DNA is "condensed", that is how tightly the DNA is wrapped around histone proteins. The more condensed the DNA, the less accessible it is to RNA Polymerase for transcription. The less condensed the DNA, the more accessible for transcription. 

 nitrogenous base

making copies of DNA = DNA Replication

How do Prokaryotes control their gene expression?? 

there are four versions of the nucleotide monomer.
This is one of them with a
nitrogen base called adenine.
We call this nucleotide Adenine and use the letter A as shorthand

3. Translational Regulation:

 a. ribosomal activation 
​b. RNA stability

uh, what's a ribosome ?

 DNA monomer
 DNA nucleotide structure:

1 deoxyribose sugar (5C)
1 phosphate group
1 nitrogenous base (A,T,C or G)

    acetylating histones                loosens DNA =
   permits transcription

1. Before Transcription:
Transcriptional Regulation using (a) transcription factors and (b) epigenetic tags

 methylating cytosines tightens DNA               = ​prevents transcription

phosphate group

2. Post-Transcriptional Regulation:
​transcript modification using
a. intron/exon splicing
b. methyl cap
​c. poly A tail

how do mutations affect phenotype?

example 1:
 modifying expression of the GR gene:
The glucocorticoid receptor (GR, or GCR) also known as NR3C1, is the receptor to which cortisol and other glucocorticoids bind. The GR is expressed in almost every cell in the body and regulates genes controlling development, metabolism, and immune response.

insertion

so what's tRNA ??

​pleiotropic effects including yellow fur, maturity-onset obesity, hyperinsulinemia, insulin resistance, hyperglycemia

Now that we have discussed what DNA is and how it is used as a template to assemble proteins, let's take a look at how our DNA is regulated...how your cells are able to "decide" which genes to use (turn on expression) and which to not use (turn off expression.  

Foods high in L-methylfolate include:

tag = acetyl group 

Current Topics in molecular biology

Now that we know how DNA serves as the cookbook to make proteins, what happens when there is a typo in the recipe...
 a mutation in the DNA??

    point mutations can be:
 a.  substitutions
​ b. insertions or deletions